WinterJwin
WinterJwin WinterJwin
  • 11-07-2018
  • Mathematics
contestada

7 (5a-4)-1=14-8a
What answer would I get?

Respuesta :

yourlilgirl
yourlilgirl yourlilgirl
  • 12-07-2018
I get a=1

Combine like terms: 14 + 29 = 43
43a = 43

Divide each side by '43'.
a = 1

Simplifying
a = 1

Answer Link
Kylenelms Kylenelms
  • 12-07-2018

I get a = 41/ 43. 7 * 5a= 35a, 7 *-4= -28, combining like terms I get 43a=41

Answer Link

Otras preguntas

which of these was a result of the treaty of Brest-Litovsk? A. The end of world war 1 B. Russia's withdrawal from the war C. The end of Austria-Hungrays war w
3+1/4x greater than 11
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
In a probability experiment, Craig rolled a six-sided die 55 times. The die landed on a number greater than three 31 times. What is the ratio of rolls greater t
How to change 3 7/8 into an improper fraction
Which is an example of a structural adaptation of a plant? A. plant moving toward light to increase photosynthesis B. roots responding to gravity to get to wa
A recipe call for 2 cups of water for every 5 cups of flour. How many cups of water are needed for 1 cup of flour? A. 2 1/2 cups B. 2 cups C. 1/2 cup D. 2/5 cup
why did Mr Collins come to the Bennet family looking for a wife?
How did i travel irf i went from nyc to tren ton a distance of90 miles at45 miles per hour how long did it take
Give a recursive algorithm for finding the sum of the first n odd positive integers.