Dogg2148 Dogg2148

03-10-2018
Biology

contestada

what is the smallest size category of soil
A. Sand
B. Clay
C. Gravel
D. Silt

APEX!!

Respuesta :

MalakMselg MalakMselg

03-10-2018

B. Clay particles are the smallest

Answer Link

slynns3702 slynns3702

03-10-2018

It would be sand because it is broken down in to little grains

Answer Link

Otras preguntas

. On Mary’s MP3 player for everly 3 pop songs Maria had she also had 4 country songs. If she has 15 pop songs on her MP3 player, how many country songs does she

2 square root of x / square root of x multiplied by 3

A train leaves Boston at 10:20 AM and arrives in Stamford at 1:00 PM. Find the distance between the stations if the average speed of the train is 60 mph.

Which of the following changes to Afro-Eurasian intercultural exchanges occurred in the 13th and 14th centuries as a result of Constantinople’s weakening and th

Given the sequence ATGGCGAATCACGTCACTTGA a) Write the sequence of nucleotides for the complementary strand of DNA. b) Write the mRNA sequence transcribed from t

The process by which water vapor in the atmosphere cools and becomes a liquid is called

what are the missing blanks

f(x) = 9 - x, g(x) = x2 + x, h(x) = x - 2 Compute the following: f(g(x)

Order the numbers from least to greatest [ -8, -6, -5, -7] a. -5, -6, -7, -8 b. -6, -5, -8, -7 c. -7, -6, -8, -5 d. -8, -7, -6, -5

round off 6406 to the nearest thousand