lilxems
lilxems lilxems
  • 02-11-2018
  • Mathematics
contestada

8f+3-4f=12 answer in decimal

Respuesta :

smartalextutoring12
smartalextutoring12 smartalextutoring12
  • 02-11-2018

9/4 or 2.25

hope that helps

Answer Link
hannamh2003
hannamh2003 hannamh2003
  • 02-11-2018

the answer is 1.8. i got that by subtracting 3 from both sides the combining like terms then dividing by 4.


Answer Link

Otras preguntas

what is the answer to #16???? Helpppppp
An important change in the american family in the nineteenth century was
Which ordered pair is a solution to the system of equations? {2x−y=−1 {2x−4y=8 A-(−2, −3) B-(8, 2) C-(1, 3) D-(7, −5)
What will be the value in twenty years of $1000 invested at the end of each year for the next twenty years?
How did the Berlin Wall change the course of the Cold War? Please Give Three Reasons How, Thank You
please answer this im dying here
Which of these describes an endothermic process? When lithium is placed in water, the temperature of the container increases. The combustion of kerosene re
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
NEED HELP ASAPPPPPPP
Use the excerpt to answer the question. We hold these truths to be self-evident: that all men and women are created equal; that they are endowed by their Creato