tanner45clifton tanner45clifton
  • 01-03-2019
  • Mathematics
contestada

#19please help me on number19

19please help me on number19 class=

Respuesta :

rhondac79c79 rhondac79c79
  • 01-03-2019

Answer:

remember rise over run

8 over 4 = 2m

Step-by-step explanation:

Answer Link

Otras preguntas

I want to work with LDAP. what is LDAP?
what rule does static electricity follow
Angie takes a random sample of 100 students in her school and finds that 58% of the sample prefers art over music. There are 1,200 students in the school. Based
What are some methods used by Mussolini to rise to power?
Thank you Philo for your answer. I have one more question for you regarding the same rectangular prism that is 3 units long, 2 units wide and has 7 layers and 4
what rule does static electricity follow
What is the adjective in the following sentence? The yellow sun hung brightly in the sky. a. Brightly b. Sun c. Yellow d. Hung
The length of a rectangle is 4 times its width and the perimeter is 150 feet. What is the width of the rectangle? A. 75 feet B. 30 feet C. 15 feet D. 60 fe
Please help me!!!!!!!!!!!!!!!!!!!!! Arusha draws a rectangular prism that is made up of two connected cubes, each with side length e. The surface area of a cert
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5