dylancastellanos77 dylancastellanos77
  • 02-04-2019
  • Mathematics
contestada

x = 2.5 5y + 2x = -10

Respuesta :

blakeedwards2019
blakeedwards2019 blakeedwards2019
  • 02-04-2019

Answer:

y = -3, x = 2.5

Step-by-step explanation:

5y + 2x = -10 if x = 2.5

5y + 2(2.5) = -10

5y + 5 = -10

5y = -15

y=-3

Answer Link

Otras preguntas

NEED HELP FAST!!! The difference of the values of the third quartile and the median of the data set represented by the box plot is (Pictured Below)
A relation is A. the output (y) values of the relation B. the input (x) values of the relation C. a set of points that pair input values with output values D. x
What do the tympanic membranes do for the frog?
PLEASE HELP!!!! NEED HELP!!!! An automotive insurance company has 25,000 policyholders. The accident rate is 0.07. The number of accidents the company will hav
which statement is true for a career as a graphic designer?
Using the point-slope equation, find the equation containing (-2, -4) and slope m = -1
_____design in construction engineering may show that you need to excavate at the construction site before you can buildA. TopographicalB. GeographicalC. Geol
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Explain the translation process that results in production of a polypeptide
Why was the sinking of the Lusitania important? A. It highlighted British aggression towards neutral shipping. B. It kept the United States out of