23sagec881 23sagec881
  • 04-02-2020
  • English
contestada

What is ethos, pathos, and, logos

Respuesta :

saturns
saturns saturns
  • 04-02-2020

logos is writing that appeals to LOGIC, ethos appeals to ethics (what someone believes is morally right, etc), and pathos appeals to EMOTION.

logos and ethos are easy to remeber since LOgos/LOgic and ETHos/ETHics :p

Answer Link

Otras preguntas

Exercise has numerous health benefits. It conditions your heart and lungs and helps your body fight disease. Many people believe that exercise can help you look
Express the area of a rectangle with length 7ab and width 2a as a monomial.
The_____ form acidic compounds with hydrogen.
Solving this question
Sugar melts at 367°F. What is the melting point of sugar on the Celsius scale?
A federal program that guarantees benefits to qualified recipients is a(n) ________ program
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Your best friend has been feeling sad for more than two weeks, and you are concerned that he may be experiencing depression. How can you have a positive impact
a food worker prepares a raw fish fillet for cooking. what food hazard must be removed during preparation?
Where did the majority of people t ravel from who were heading to make a new life out of the west?