bkhurst5 bkhurst5

01-03-2020
Mathematics

contestada

2. What is the value of x in the drawings if we know the triangles are similar?
3 ft
15 ft
6
ft

Respuesta :

verejan14 verejan14

03-03-2020

Answer:

The answer is 3 ft

Step-by-step explanation:

because if they are all similar then it will be 3 ft

Answer Link

Otras preguntas

can you guys help me with this simple math problem ?

why does the troposphere experience the greatest amount of atmospheric pressure compared to the other atmospheric layers?

Adair needs $21,150 to purchase a boat. How much money will you need to invest today in a savings account earning 3.2% interest, compounded monthly, to have en

The element with the most stable nucleus and smallest mass per particle is

Which of these hormones does not help control fluid balance during exercise?

What is the value of x?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

What brings the u.s. into this war? - 1. economic factors (natural resources and new markets 2. nationalistic factors (competition to create an empire/prove you

Can you give me a short summary (a sentence or two) on Shakespeare’s Macbeth. And what it is.

A line with an underfined slope contains the point (8,3). The point (?, -4) is also on the line. What is the missing x-coordinate?