yohadrianaf yohadrianaf

01-04-2020
English

contestada

The king and Jennifer Perez were invited to Brazil. What are the nouns

Respuesta :

Gnarlynarwhal1333 Gnarlynarwhal1333

01-04-2020

Answer:

The king, Jennifer Perez, and Brazil

Explanation:

Remember, a noun is a person, place, thing, animal, or idea!

Answer Link

Otras preguntas

(1) Suppose the world price of steel falls substantially. The demand for labor among steel-producing firms in Pennsylvania will _______. The demand for labor am

The uniform slender bar AB has a mass of 7 kg and swings in a vertical plane about the pivot at A. If angular velocity of the bar is 3 rad/s when θ = 35o , comp

The mathematics department of a college has 15 male professors, 14 female professors, 6 male teaching assistants, and 11 female teaching assistants. If a per

If you are in an emergency scenario and have forgotten how to use an AED, what should you do? Do nothing until the EMTs arrive. Listen to the voice instructions

Square root of -3 find the square root of -3

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA

Special Agent Collins is a new agent with the Drug Enforcement Agency. He has been investigating a multi-tiered heroin trafficking ring. Special Agent Collins h

2. Which one of the following statements are true of the sample of matter described by Figure1?a. As heat is added to the sample, its temperature always increas

What is the relationship between auxin and phototropism?

The point (-2, - 5) is on the line given by which equation below?