francogenesis46 francogenesis46

03-04-2020
Mathematics

contestada

solve the following proportion for x 13/7 = x/9

Respuesta :

03-04-2020

117/7

Or mix number 16 5/7

Answer Link

Otras preguntas

How can longshore currents be dangerous to swimmers?

Mary is in an automobile accident and suffers a spinal cord injury. She has lost feeling in her lower body. Her doctor tells her that swelling is compressing a

The kidney is referred to as an excretory organ because it excretes ______ wastes. It is also a major homeostatic organ because it maintains the electrolyte ___

Long Construction Company uses the percentage-of-completion method of accounting for long-term construction contracts. During 2021, Long began work on a $400 mi

just doing this for fun 50 points. 12 * 12

Mixing lime green and scarlet red would result in what outcome?

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template

A section in a contract that ensures that providers of goods and services do not encounter unreasonable financial hardship as a result of uncontrollable increas

what are the major atomic bonds GIVING 20 POINTS Will give BRAINLIEST to the BEST ANSWER

D=h+9 The variable H represents the number of hours worked, and the variable d represents the amount of dough prepared how many hours did Eli work if he prepare