emilyingram emilyingram
  • 03-05-2020
  • Medicine
contestada

What bone are babies born without

Respuesta :

brownlatoya3 brownlatoya3
  • 03-05-2020
Kneecaps is the answer
Answer Link
maggie81047 maggie81047
  • 04-05-2020
Kneecaps Are the only thing babies are born with out
Answer Link

Otras preguntas

What colony was established for persecuted Roman Catholics?
simplify (-34.67)^0​
What is individual racism in your own words and writing a summary​
What is the density of an object with a mass of 16 g and 3.0 ml
How do you build yourself up mentally or emotionally to overcome obstacles, to tackle bigtings in your life or to face life's challenges head on? How do you bu
A ball is launched directly upward and ultimately reaches a height of 40 ft on a day when the wind is gusting in different directions. From the time the ball is
What is the graph of each function rule? 4. Y=|x|-1
HELP WILL GIVE CROWN I NEED HELP FAST!!!!!!!!!!
Given the sequence ATGGCGAATCACGTCACTTGA a) Write the sequence of nucleotides for the complementary strand of DNA. b) Write the mRNA sequence transcribed from t
What sphere caused the event?