Iwritewithpencils Iwritewithpencils

14-05-2020
Biology

contestada

How do I use a codon wheel to solve this sequence of DNA?

AGTACCCGTTAATTAGTTGCCG

Respuesta :

andyk38105 andyk38105

14-05-2020

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

Answer Link

Otras preguntas

Tom bought five candy bars and paid a total of $6.75, including tax. If each candy bar cost $1.25, how much tax did Tom pay? A) $0.25 B) $0.50 C) $0.75 D) $5

Convert 5.764764764... to a rational expression in the form of a/b where b=0

There was an Open Door policy between the U.S. and the other countries that traded in China. True False

Match the equation with the step needed to solve it. 1. 2m - 1 = 3m add 1 2. 2m = 1 + m

Gussie is making a perfect idiot of himself.' To one who knew young Gussie as well as I did, the words opened up a wide field for speculation. 'In what way?' 'H

...indeed whilst on the one hand civil disobedience authorizes disobedience of unjust laws or immoral laws of a state which one seeks to overthrow, it requires

What is the measure of angle Xyz

What are the strengths and weaknesses of the union/the Confederate States during the civil war

If there is Is large amount of lactose present, how does bacteria respond? A. the gene for beta-galactosidase turns on. B. the gene for beta-galactosidase t

If you send a sound wave of the same wavelength (λ = 2.00 m) through air, helium, and carbon dioxide, describe how the pitch of the sound will compare through e