sophiafriend34 sophiafriend34
  • 15-05-2020
  • Biology
contestada


Is the below sequence DNA or RNA? How do you know?
GTTTACAGGCGGCGCAATATCTGATCG

Respuesta :

queenb74
queenb74 queenb74
  • 15-05-2020
The answer is DNA I know because I know
Answer Link
savitar0291 savitar0291
  • 15-05-2020

Answer: DNA

Explanation: DNA has Thymine, Guanine, Cytosine, and Adenine.

RNA has all of those except for adenine which is replaced with Uracil.

Answer Link

Otras preguntas

Why were pill taxes and literacy(reading) test an effective measure to limit African American right to vote?
brainly- How does littering affect humans?
What type of government does Brazil have? A. a democratic republic B. an authoritarian dictatorship C. a theocracy D. a military junta Please select the best an
Write in standard form the equation of a line with a slope of -3/5 and a y intercept of -3
Can somebody give me a detailed equation for this angle, I already have some but i need more thank you.
(can someone please help me answer this question i will make you brainliast)
mention four benefit of responsible citizenship​
How do u guy do this
write the inequality that describes the graph​
Balance the following equation using oxidation Numbers. Show all steps. KMnO4(aq)+ H2SO4(aq) +H2O2(l)-> K2SO4(aq) +MnSO4(aq) + 02(g) + H2O(l)