sujanmanisha321 sujanmanisha321

01-11-2020
Biology

contestada

Give reason Leaf is modified into thorn where water availability is low

Respuesta :

CarolineMars1 CarolineMars1

01-11-2020

Answer:

In plants like Gloriosa Superba, The leaf tips get elongated and become tendrils. In some plants like Lathyrus aphaca , the entire leaf gets modified into a tendril and the stipules expand to carry out the function of a leaf.

Hope this helps !

Answer Link

Otras preguntas

transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-

Levi is replying to an email a customer sent seeking information about his company’s products. Which greeting should he avoid using in a business email? A. Hi

there are 20 total students in Kim's class. 12 of the students are boys and 8 are girls. which of the following reqesents the part of the class that is boys

Which of the following is not a major import of the United States? Medical products Textiles Electronics Oil

what part of history was propaganda used very heavily

which invention helped farmers plant crops more quickly and efficiently

What type of function is this: a1 = 2 an = an-1+4 Arithmetic and Explicit Arithmetic and Recursive Geometric and Explicit Geometric and Recursive

Plz can someone answer this for me

А_______is part of the population chosen to represent the entire group.

Why was a measure of self-government necessary in the colonies during the colonial era? A. Self-government was the only way to protect North American colonists