luis356demaria luis356demaria
  • 01-12-2020
  • Mathematics
contestada

If x=-2
f(x) = g(x),
is a solution to the equation
'which of these statements must be true?
The graphs of fand g intersect each other at
X = -2.
The graphs of f and g intersect each other at
X = 2.
-2.
The graphs of fand g intersect the x-axis at
-2.
The graphs of f and g intersect the y-axis at

Respuesta :

0481046 0481046
  • 02-12-2020

Answer: I THINK it’s A

Step-by-step explanation:

Answer Link

Otras preguntas

How to change 3 7/8 into an improper fraction
How to change 3 7/8 into an improper fraction
Which of the following is the modern counterpart of the journal and diary? a. A magazine article b. A blog c. A speech d. A newspaper article
A recipe call for 2 cups of water for every 5 cups of flour. How many cups of water are needed for 1 cup of flour? A. 2 1/2 cups B. 2 cups C. 1/2 cup D. 2/5 cup
The area of the base of a prism is 50 mm2. The perimeter of the base is 30 mm. The height of the prism is 7 mm. What is the surface area of the prism?
The section of the small intestine between the duodenum and ilium?
31+34=90-n 45+1=70-k 6×9=41+m
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
The section of the small intestine between the duodenum and ilium?
What are the factors of 6x + 24?