vikky85 vikky85
  • 03-12-2020
  • Chemistry
contestada

help with this question

help with this question class=

Respuesta :

vinny1203 vinny1203
  • 03-12-2020
Complementary DNA strand have the letters switched from each other. That would be:

A -> T OR T -> A
And
C -> G OR G -> C

As well as the direction of the strand:
5’ -> 3’ to 3’ -> 5’


For the first set:

DNA: 5’ - ATTATCGCGTAGCTAGCAGT - 3’
Comp: 3’ - TAATAGCGCATCGATCGTCA - 5’

As you can see the strands are the opposite from one another.

Try out the second set of strands and if you’re still having struggles let me know in the comments (:
Answer Link

Otras preguntas

Do you know this for social studies
NEED ANSWER ASAP The perimeter of a rectangle is 60m^2 and the length is twice as long as the width. Find the length, width, and area.
When 4050 joules of heat were applied to 150g of aluminum, the final temperature was 50 degree Celsius. What was the initial temperature? Take specific heat cap
A number of students are evenly spaced around the circle. The fourth student is directly opposite the tenth student. How many students are there altogether?
How was life difficult for enslaved Africans in colonial America?ASAPPlease
Find the 50th term of the following arithmetic sequence 5, 9, 13, 17?
prove this questionplease​
Biological psychopathology is the study of the genetic influence on ______ processes, A. growth B. cognitive C. social
Find two rational numbers between the root of 2 and root 3​
measure to conserve our heritages ?​