eboblitt24 eboblitt24

03-12-2020
Mathematics

contestada

write the sentence as an inequality. then solve the inequality.
the difference of 5 and a number is at least 13

Respuesta :

Аноним Аноним

03-12-2020

Answer:

-5a<13

Step-by-step explanation:

Answer Link

Otras preguntas

Paul has grades of 86 and 85 on his first two tests. what must he score on his third test in order to have an average of at least 90

Which aspect of communist economies kept them from matching the production efficiency and quality of free market economies

Using the point-slope equation, find the equation containing (-2, -4) and slope m = -1

Define the principles of self boundaries and explain how it impacts medical assisting

A major problem facing italy after its unification was select one: a. papal interference in political elections b. the uneven economic development of the north

how is mechanical weathering best described A. The buildup of chemical deposits on the surface B. The breakdown of rock through mechanical disintegration and ph

what is r in this equation? πr^2=42π

which statement is true for a career as a graphic designer?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Boris has scored 80, 93, 63, 83, and 83 on his previous five tests. what score does he need on his next test so that his average (mean) is 79?