Seudónimo Seudónimo
  • 01-02-2021
  • History
contestada

What civilization built the first cities in Mesopotamia?

A

Babylonians

B

Sumerians

C

Akkadians

D

Lydians

Respuesta :

bryan4433 bryan4433
  • 01-02-2021
Sumerian civilization so it’s letter B
Answer Link

Otras preguntas

The energy content and biomass of ________ is lowest in a terrestrial food web. The energy content and biomass of ________ is lowest in a terrestrial food web.
Question 4 (1 point) 4. What is the solution of the equation v3x – 2 - 1 = 4?
Describe one method to calculating the area of the shaded region.
Please help numbers 2-20 evens only
This is the measurement from bottom to top of something. How tall something is.
A 500 turn coil is wound on an iron core. When a 120Vrms 60Hz voltage is applied to the coil, the current is 1A rms. Neglect the resistance of the coil. Determi
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template
Please help veterinary science! What is bovine spongiform encephalopathy? Why is there concern about this disease? at least 3 sentences
What volume is occupied by 21.0 g of methane (CH4) at 27 degrees Celsius and 1 atm?
How does god’s mercy enter into our salvation