richelle168yahoocom richelle168yahoocom

04-11-2016
Mathematics

contestada

Andrea's dad is 57 kilograms heavier than Andrea. Andrea weighs 34 kilograms. how much do Andrea and her dad weigh in total

Respuesta :

Аноним Аноним

04-11-2016

Dad = 57 kg + Andrea
Andrea = 34 kg

Dad = 91 kg, because 57 kg + 34 kg = 91

Total they weight 125 kg, because 91 kg + 34 kg = 125 kg

Answer Link

Аноним Аноним

04-11-2016

57+34=91 kilograms
Andrea's dad is 91 kilograms

Answer Link

Otras preguntas

Helppppp how do u do this????

Why did the United States go to war with Britain in 1812

Does the increase in blood glucose levels increase the viscosity of the blood

Given the sequence in the table below, determine the sigma notation of the sum for term 4 through term 15. n an 1 4 2 −12 3 36

Which phrase refers to failed businesses? a. "the withered leaves of industrial enterprise" b. "serious curtailment of income" c. "no markets for their produce"

The montreal school of scholars have drawn together a still-growing framework about the ways in which communication constitutes organization.

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

(50)points 5 questions

Solve the given inequality and graph the solution on a number line. I need it on a graph -x/2 +3/2 <5/2

What is the interquartile range of the data? 17, 18, 18, 20, 23, 25, 27, 27, 34, 38, 40, 46, 46, 62, 67