milly1684 milly1684

03-04-2021
Mathematics

contestada

1. What is the tax owed by an individual with an annual income of 40,000.

Respuesta :

estelancedeno estelancedeno

03-04-2021

Answer:

4,000

Step-by-step explanation:

If you are single and a wage earner with an annual salary of $40,000, your federal income tax liability will be approximately $4,000.

Answer Link

Otras preguntas

Which pair of verbs best completes this informal imperative sentence? ________ y _________ todo sin límite. Beba, coma Bebe, come Bebemos, comemos Bebis

how is the graph of y=9(3)^x+2 +6 translated from the graph of y+9(3)^x

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Solve the given inequality and graph the solution on a number line. I need it on a graph -x/2 +3/2 <5/2

The federal government's insurance program for the elderly and disabled is called:

Explain how infection prevention policies and guidelines can be applied in own work setting.

Decide if the following command is grammatically correct or incorrect. (tu) no digo mentiras.

i will mark as brainiest you answer this easy question

A cat falls out of a tree and takes 1.4 seconds to land safely on its paws on the ground how many meters did the cat fall ?

N the world's lowest-income nations, two in ten children born die by the age of