ARTaylor2006
ARTaylor2006 ARTaylor2006
  • 02-02-2022
  • History
contestada

what were the results of the constitutional convention?​

Respuesta :

sofixsss2005 sofixsss2005
  • 02-02-2022
The result of the convention was the creation of the Constitution of the United States, placing the Convention among the most significant events in American history.
Answer Link

Otras preguntas

In which sentence does the prepositional phrase act as an adverb? A. Last evening, Anne suffered from a headache. B. The door to the attic was left open. C. Mr
How did i travel irf i went from nyc to tren ton a distance of90 miles at45 miles per hour how long did it take
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
4(3-5)=-2(8-z)-6z what is z
what is the percent change from 70 to 56?
Jimmy pays $2.93 for each gallon of gas. Which table best represents the relationship between g, the number of gallons purchased, and m, the amount he pays for
What are the qualities of a good topic? How will you ensure the topic you choose is relevant and interesting?
Complete the sentences with seem, look or sound and use like or as if when necessary. 1) Quick! Emma's an the phone. She... she's calling from a long way away.
20 points People disagree whether the United States should have gone to war against Mexico. Should the United States have declared war? Opinions Please The Unit
a summary about concussions