linw66446
linw66446 linw66446
  • 04-06-2022
  • Mathematics
contestada


Given: MN is twice the length of
KM and KM = 8. Find the
perimeter of the total figure.
A. 24
B. 28
C. 38
D. 48

Given MN is twice the length of KM and KM 8 Find the perimeter of the total figure A 24 B 28 C 38 D 48 class=

Respuesta :

Аноним Аноним
  • 05-06-2022

MN=2KM

  • 2(8)
  • 16

MN+KM=24

  • QP/KJ=MN/MK=24/16=3/2

As we can see

QP is almost greater than 3/4th MN

It's atleast 10+ or even 12+

So possible perimeter excluding QJ and KJ is atleast 34 to 36 .

So it can neither be 38 nor 28 .

Only one option yields that's 48(Option D)

Answer Link

Otras preguntas

How can you make a high estimate for the sum of two factions in a word problem
Where is the kingdom of Israel located?
Historically, the Huang He (Yellow) has also been known as the "River of Sorrows" because a floods have destroyed crops and villages b burials have taken place
Where is the Ob River in Asia?northeastwestsouth​
Which organism will have DNA most similar to the bird? Why?
at the end of the year dahir incorporated's balance of allowance for uncollectible accounts is $2700 (credit) before adjustment. the company estimates future un
Consider the following aggregate planning problem for one quarter: Regular Time Overtime Subcontracting Production Capacity/Month 1,000 200 150 Production Cost/
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template
In a large population, 70 % of the people have been vaccinated. If 3 people are randomly selected, what is the probability that AT LEAST ONE of them has been va
What polygon has 6 sides and 6 angles?