Kady1234 Kady1234
  • 04-02-2017
  • Mathematics
contestada

How to convert 3.9 meters to centimeters

Respuesta :

Elsakabeche
Elsakabeche Elsakabeche
  • 04-02-2017
You know 100 cm is one meter. So you multiply 3.9 by 100 = 390


Plz mark mine the brainliest answer:) hope this helped
Answer Link
etms99 etms99
  • 04-02-2017
you carry the decimal point two times over to the right and you get 390 centimeters 
Answer Link

Otras preguntas

Susan ........ (Run) to school because she was late.
In a probability experiment, Craig rolled a six-sided die 55 times. The die landed on a number greater than three 31 times. What is the ratio of rolls greater t
Why was wilson not able to finish his speaking tour
On Being Brought from Africa to America by Phillis Wheatley 'Twas mercy brought me from my Pagan land, Taught my benighted soul to understand That there's a God
Please answer theses division problems!! 9 divided by 3/7
Ms Graves gave her class 12 minutes to read. Carrie read 5/1/2 pages in that time. At what rate, in the pages per hour, did Carrie read?
one-third of the fish in Liam's fish tank were added today. Half of the other fish were a gift to Liam last week. the other 9 came from Liam's old fish tank.
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
COMPARISON; 1. How is concrete like chocolate 2. How is a shirt like a picture 3. how is an elephant like a cloud
Can someone explain the equation Q = M C delta T or Q = MCΔT Thanks!