Seudónimo Seudónimo
  • 13-02-2015
  • Mathematics
contestada

A circle is divided into 6 equal sectors. Find the measure of the central angle of each sector. PLEASE HELP

Respuesta :

standavidyuk standavidyuk
  • 13-02-2015
Full circle= 360 degrees

360/6=60

The central angle of each sector is 60 degrees
Answer Link
mattikimmell1 mattikimmell1
  • 13-02-2015
360° is the full circumference of a circle so you would take 360 ÷ 6 because you have 6 equal sectors, which should give you 60
Answer Link

Otras preguntas

It takes Jamil 40 minutes to drive to work, plus or minus 8 minutes depending on traffic. Which of the following equations could be solved to find the shortest
HELP!! ASAP PLEASE!! BRAINLIEST BEING GIVEN!
Given the sequence ATGGCGAATCACGTCACTTGA a) Write the sequence of nucleotides for the complementary strand of DNA. b) Write the mRNA sequence transcribed from t
3.Calculate the acceleration of a 1kg toy airplane that has been thrown with a force of 20N.
A female, tortoise-shell, tailless Manx cat mates with a male solid black tailless Manx cat. Their first litter produced 1 tailless tortoise-shell female, 1 tai
It’s timed please help 3.2b-4.7b=3b-3.3 What dose b equal
The mechanical action of friction causes: chemical energy heat energy potential energy
what equation could be represented by the number line
Plz help i need it done fast
What is your favorite piece by shakespear and why