kay0leeckrs9on kay0leeckrs9on
  • 03-03-2017
  • Business
contestada

What is a credit score intended to measure?

Respuesta :

Аноним Аноним
  • 09-03-2017
A credit score is a numerical point system based on a select credit report characteristics. There is no direct relationship to financial credit scores used in the lending decisions, as insurance scores are not intended to measure credit worth but rather to predict risk
Answer Link

Otras preguntas

What is the difference between "Herr" and "Herrn"?
The _______ system breaks down food, and the _______ system transports nutrients to the cells of the body.
Why was wilson not able to finish his speaking tour
The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
A tabletop in the shape of a trapezoid has an area of 6,550 square centimeters. Its longer base measures 115 centimeters and the shorter base is 85 centimeters.
How to change 3 7/8 into an improper fraction
Ms Graves gave her class 12 minutes to read. Carrie read 5/1/2 pages in that time. At what rate, in the pages per hour, did Carrie read?
How do I factor polynomials by grouping, step by step? 4x^2 - 19x+ 12
i need help with this question