Tess4746 Tess4746
  • 02-11-2017
  • Social Studies
contestada

Child care that occurs in the home of a nonrelative who usually cares for several children of various ages is called

Respuesta :

mcba1234
mcba1234 mcba1234
  • 02-11-2017
Would this be considered to be a nanny?
Answer Link

Otras preguntas

Please help me with this
Like Father Like Mother What is the best summary of this oassage
What is the main reason people get divorced?
Based on the two passages, how did the two groups view the land that they now call home? Moravians and Germans Edge
What is a monochromat? A. A person that can see all colors B. A person that is totally color-blind C. A person that always dresses in one color D. A person that
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
the key reasons that an organization should adopt planning and strategic management are to:
He ……to work by car ? (Travel)
An airplane accelerates down a runmway at 2.9 m/s/s for 38.5 seconds until if lifts off the ground. Determine the distance traveled on the runway before taking
reason that stops you from traveling