jiaruiwu6615 jiaruiwu6615

01-05-2018
History

contestada

What was the name of the philosopher that influenced thomas jefferson when writing the declaration of independence?

Respuesta :

dearrachelxo dearrachelxo

01-05-2018

I'm certain it was John Locke.

Answer Link

Otras preguntas

Gerri says that a spider use their fangs for the same purpose that crustaceans use their claws. Alana disagrees and says that spiders use their fangs for the s

1. Read this excerpt from The Narrative of the Life of Frederick Douglass. I could not approach her as I was accustomed to approach other white ladies. My early

What did Chinese traders exchange with Islamic merchants?

Jacky spent 53% of all her money to buy a computer game. How much did the game cost, if Jacky had $120 before buying the game?

When did the eastern part of the Roman Empire fall?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

what is the theoretical probability of picking a diamond from a standard deck of car

I'm doing C++. When i multiply 200000 by 200000, i get 1345294336. I wrote long long x = 200000 * 200000 cout << x << endl;

what does the liver do in the excretory system

The equation 2x2 + 5x - 12 = 0 is factored. Each factor is set equal to zero. What are these two equations?