queenbaby8000
queenbaby8000 queenbaby8000
  • 02-02-2022
  • Mathematics
contestada

Pls pls plsssssssss help me and fast

Pls pls plsssssssss help me and fast class=
Pls pls plsssssssss help me and fast class=
Pls pls plsssssssss help me and fast class=

Respuesta :

zarishere
zarishere zarishere
  • 02-02-2022

Answer:

11/24

Step-by-step explanation:

use Fraction calculator

Answer Link
Аноним Аноним
  • 02-02-2022

Answer:

I hope it's helpful for you

Ver imagen Аноним
Answer Link

Otras preguntas

The $54 selling price of a sweater is the cost increased by $18. Find the cost.
What do these details help you understand Soto?
find m angle C to the nearest degree.
how old is aber wiggins
Read the following quote... “When you fall like a statue”. What type of firgurative language is this and what does it mean?
How do I use a codon wheel to solve this sequence of DNA? AGTACCCGTTAATTAGTTGCCG
Do you think Holmes took unnecessary risks with Sir Henry's life?
Please help me with this
Which part of Alexandria was considered one of the Seven Wonders of the Ancient World? a. the Library of Alexandria b. the Naval Base of Alexandria c. the Light
) listen 4. Ming's vegetable garden has the shape shown below. What is the area of the entire garden? 6 m 6 m 3 m