Laight7752 Laight7752
  • 03-02-2018
  • Business
contestada

_____________ divide a distribution into four groups, and __________divide a distribution into ten groups

Respuesta :

LearnGrow
LearnGrow LearnGrow
  • 14-02-2018
Quartiles divide a distribution into four groups, and deciles divide a distribution into ten groups.
Both quartiles and deciles are statistical term that describe a division of observations. The term quartiles describes division into four defined intervals based upon the values of the data and deciles into ten defined intervals.
Answer Link

Otras preguntas

He earned a salary of $80,000 last year and sold stocks for $5,000. Which of the following types of income did Padraig have?
Which statement best explains how the effect of a particular allele can change the genetic makeup of a population over time?
a circle has the diameter of 42 what is the circumference of that circle
(03.04 HC) A woman gives birth to a son who has type O blood. She has type B blood. Which of the following can be concluded from this about her parents' blood t
Answer the following question in 1-2 complete sentences. Name the three main types of Intaglio printing.
Need help with this assignment please
Slove 2/3x-1/5>1. X>
Which two countries had improved relations with the US during the presidency of Bill Clinton?
The following sentence uses which principle part of the verb he is swimming in the deep in the pool
Is the below sequence DNA or RNA? How do you know? GTTTACAGGCGGCGCAATATCTGATCG